Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GMS32

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GMS32
Reference	Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute.
General Remarks	SSR motif: (CT)1 3(GT)3 (AT)3(CT)3GA
Type	SSR
PCR primers	ATTTGACGAGAAGGACCGG CACTAAAGGGAACAAAAGCTGG
SSR size	166
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 60C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.