Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GMS6

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GMS6  [ Marker Report ]
Locus	GMS0006 GMS006 GMS6
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Waugh R and Marshall DF (2005) Barley SSRs from the Scottish Crop Research Institute. Struss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks	SSR motif: (GA)2ATA(GA)19
Type	SSR
PCR primers	TGACCAGTAGGGGCAGTTTC TTCTTCTCCCTCCCCCAC
SSR size	154
Amplification Conditions	35-45 cycles: 1 min @ 94C, 1 min @ 55C, 2 min @ 72C; 1 cycle: 60 mins @ 72C.