Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GLU LMW1/2

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GLU LMW1/2  [ Marker Report ]
Locus	Glu-3
Reference	D'Ovidio R (1993) Single-seed PCR of LMW glutenin genes to distinguish between durum wheat cultivars with good and poor technological properties. Plant Molecular Biology 22:1173-1176.
Type	STS
PCR primers	CGTTGCGGCGACAAGTGCAA GTAGGCACCAACTCCGGTGC
Specificity	LMW primers to distinguish between durum wheat cultivars possessing LMW-2 or LMW-1 glutenin subunits
Source Gene Class	Glutenins
Source Species	Triticum aestivum L. em. Thell. Triticum aestivum