Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GLU Dx5

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GLU Dx5
Reference	D'Ovidio R and Anderson OD (1994) PCR analysis to distinguish between alleles of a member of a multigene family correlated with wheat quality. Theoretical and Applied Genetics 88:759-763.
Type	PCR STS
PCR primers	GCCTAGCAACCTTCACAATC GAAACCTGCTGCGGACAAG
Specificity	HMW primers specific for the 1Dx5 gene (Glu-D1-1b).
Source Gene Class	Glutenins
Source Gene	Glu-D1 (Triticum)
Source Allele	Glu-D1a (Triticum) [ Show all 19 ]
Source Species	Triticum aestivum