Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GLU Dx

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GLU Dx
Reference	D'Ovidio R et al. (1995) Development of a set of oligonucleotide primers specific for genes at the Glu-1 locus. Theoretical and Applied Genetics 91:189-194. D'Ovidio R et al. (1994) PCR analysis of genes encoding allelic variants of high-molecular-weight glutenin subunits at the Glu-D1 locus. Theoretical and Applied Genetics 88:175-180.
Type	PCR STS
PCR primers	CCGAGATGGCTAAGCGGTTA CTGGCTGGCCGACAATGCGT
Specificity	Specific for High molecular weight (HMW) glutenin genes.
Source Gene Class	Glutenins
Source Gene	Glu-D1 (Triticum)
Source Allele	Glu-D1a (Triticum) [ Show all 19 ]
Source Species	Triticum aestivum