Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GLI 42/45

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GLI 42/45  [ Marker Report ]
Locus	Gli-1
Reference	D'Ovidio R et al. (1992) Lack of expression of the gamma-45 gliadin gene in a durum wheat genotype Journal of Cereal Science 16:173-181.
Type	STS
PCR primers	ATGAAGACCTTACTCATCCT ACATACACGTTGCACATGG
Specificity	Gamma-gliadin primers to distinguish between durum wheat cultivars possessing gamma-45 gliadin or gamma-42 gliadin
Source Gene Class	Gliadins
Source Species	Triticum aestivum L. em. Thell.