Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GIRP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GIRP
Synonym	Other name J02817
Reference	Baulcombe DC et al. (1987) A gibberellin response wheat gene has homology to yeast carboxypeptidase Y. Journal of Biological Chemistry 262:13726-13735.
General Remarks	Primers designed from wheat gibberellin responsive protein gene.
Type	PCR STS
PCR primers	R:GGTGAGCAAAGCATCCGGTT L:GCTCCTCCTGCTCGCGCTCT
Amplification Conditions	Anneal at 50oC.
Sequence	J02817
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring
Source Tissue	aleurone
PCR size	0.724