Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GBS8

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GBS8  [ Marker Report ]
Locus	GBS0008 GBS0008-2H
Reference	Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839.
General Remarks	Clone HY10K20V
PCR primers	GCCGACACATCATCTCTCAAC ATGCTCTTGTTCCTGATGAGAA
Amplification Conditions	5 min at 94 deg C; 50 cycles with 30 sec at 94 deg C, 1 min at 65 deg C (touchdown of 1 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 40 cycles), 1 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	AL509087
DNA Library	IPK-HY
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)