Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GBMS247

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GBMS247  [ Marker Report ]
Locus	GBMS0247 GBMS247
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
General Remarks	Insert contains repeat (GT)9 Primer sequences for this SSR are proprietary. Those interested should contact Marion Roeder. Primer sequences for this SSR are proprietary, those interested should contact Marion Roeder
Type	PCR SSR
PCR primers	Forward ACACCACATTCATCTTCCTTCA Reverse CATTGCTCTGCTTCCTGTCA
Source Species	Hordeum vulgare
Source Germplasm	Franka (barley)