Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GBM1075

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GBM1075  [ Marker Report ]
Locus	GBM1075 GBM1075-6H
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Stein N et al. (2007) A 1000 loci transcript map of the barley genome - new anchoring points for integrative grass genomics Theoretical and Applied Genetics 114:823-839. Thiel T et al. (2003) Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theoretical and Applied Genetics 106:411-422.
General Remarks	Primer sequences for this SSR are proprietary, those interested should contact Andreas Graner Clone HW02M04T
Type	SSR
PCR primers	CCCGACCAAGCTTTTCTCAC TGATGGTGGGCTTCTTGTTG available upon request to authors: graner@ipk-gatersleben.deGBM1076 PCR_primers
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	AL503602
DNA Library	IPK-HW
Source Species	Hordeum vulgare
Source Germplasm	Barke (barley)