Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CWM340

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CWM340
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Gao LF et al. (2003) Analysis of microsatellites in major crops assessed by computational and experimental approaches Molecular Breeding 12:245-261.
General Remarks	Repeat motif: ACG In a survey of 40 wheat varieties, 173 of 478 CWM EST-SSRs were polymorphic. In 369 Avena sterilis accessions there were 5 alleles of size 42-207 bp, PIC = negative. Repeat sequence (ACG)7
Type	PCR SSR EST
PCR primers	TGCTCCACGTGGCTGTAG GTCGTCATCGTCATCGTCAT
Amplification Conditions	Annealing temperature 50 oC
Source Species	Triticum aestivum