Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: cMWG649

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	cMWG649  [ Marker Report ]
Locus	cMWG649b [ Show all 10 ]
Synonym	Other name MWG649 Kunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27. MWG649 Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256. Synonym HAR35_4916
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CAACACTCCGTCAACCAGCAACCTC 5' GCCTGCGTTGTTGAATGCG
STS size	441
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234403 CMWG649-5
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf