Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CFP2012

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CFP2012  [ Marker Report ]
Locus	cfp2012
Reference	Paux E et al. (2008) A Physical Map of the 1-Gigabase Bread Wheat Chromosome 3B Science 322:101-104.
Type	PCR
PCR primers	Left (5'-3'):GCGTCAAACCACTAATGTCGCTG Right (5'-3'):GGAAGAGAGGAGGAAGAAGAGGG
STS size	283
Sequence	DX368757