Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AM109

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AM109
Reference	Pal N et al. (2002) Development and characterization of microsatellite and RFLP-derived PCR markers in oat Crop Science 42:912-918.
General Remarks	Insert contains repeats (AC)8(AG)5
Type	SSR
PCR primers	5' ACCCCTGTCAGAGGAACGTC 5' GGGACACATGCAAGAACCTA
SSR size	178
Amplification Conditions	58
Specificity	Polymorphism among 13 Avena species is No
Source Species	Avena sativa
Source Germplasm	Clintland 64 (oat)