Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CDO1338

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CDO1338  [ Marker Report ]
Locus	Xcdo1338-5B [ Show all 9 ]
Synonym	Other name CD1338 Synonym HAR35_7289
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Uni-ZAP XR library OatUni-ZAPXR [c]
Type	cDNA STS
PCR primers	R:ACAACTCCCCTTCACTGTTC L:GCTTTCCTTTTGCAGCAACA
Amplification Conditions	Anneal at 45oC
Sequence	BE439211 CDO1338_WHE03G04.r1 AA231929 AA231928
Polymorphism	CDO1338 EcoRV CDO1338 EcoRI
Linkage Group	4S, 5L
Insert Enzyme	EcoRI XhoI
Source Species	Avena sativa
Source Germplasm	Brooks (oat)
Source Tissue	etiolated leaf leaf
Insert Size	1.2
PCR size	1.2