Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CDO749

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CDO749  [ Marker Report ]
Locus	CDO749 [ Show all 13 ]
Synonym	Synonym HAR35_26576 HAR35_35245 HAR35_7834
External Databases	DDBJ EMBL GenBank
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Uni-ZAP XR library OatUni-ZAPXR [c] OatUni-ZAPXR
Type	cDNA STS
PCR primers	TCTCAGGAGCAGGTCAGTTA GCGGAGTAGTATTAGTCACA
Sequence	BE439150 [ Show all 7 ]
Polymorphism	CDO749 EcoRI
Linkage Group	5S,2L[b7SH] 2L,5S [b 7S]
Insert Enzyme	EcoRI XhoI
Source Species	Avena sativa
Source Germplasm	Brooks (oat)
Source Tissue	etiolated leaf
Insert Size	1.8
PCR size	1.8