Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scssr04056

[Submit comment/correction]

Locus	scssr04056
Type	Microsatellite SNP
Synonym	Other name Ctig1701 Synonym ABC04056_L01R01
Chromosome	7H
Map	Barley-ConsensusFHB-7H 155.87 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum vulgare
Probe	ABC04056_L01R01 scssr04056
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Probe for Locus	ABC04056_L01R01
Locus	scssr04056
Data at Germinate	ABC04056
Data at PLEXdb	Barley1_04056
General Remarks	Estimated product size = 141 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc04056
PCR primers	5' CCCATGAAGCCTCTTTACG 5' GGAACGGAGGGAGTATTAAGC
Sequence	Barley1_04056
Source Species	Hordeum vulgare