Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scind04312b

[Submit comment/correction]

Locus	scind04312b
Type	Indel
Synonym	Other name SNP3197B Synonym ABC04312_L01R01
Chromosome	6H
Map	Hordeum-Consensus2005-SNP-6H 118.534 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	ABC04312_L01R01
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC04312_L01R01
Locus	scind04312b scind04312a
Data at Germinate	ABC04312
Data at PLEXdb	Barley1_04312
General Remarks	Estimated product size = 183 BarleySNP type = EST Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc04312
Type	STS
PCR primers	5' CCTCCATGAAACCCTTCCTT 5' GTGGAGTGGGTCCTCAAGAA
Sequence	Barley1_04312
Source Species	Hordeum vulgare