Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuE18

[Submit comment/correction]

Locus	ksuE18
Type	RFLP
Chromosome	1H
Chromosome Arm	1HS
Map	Barley-Consensus-1H -14.3 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus Barley, BinMap 2005 Barley, GxH Wheat, Yr genes and QTL
Probe	pTtksuE18
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Probe for Locus	pTtksuE18
Locus	XksuE18-6B [ Show all 27 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TGAGCCGGTTGCTGTTCGTC L:AAGCACCGACATGGTCACCC
Amplification Conditions	Anneal at 45oC
Polymorphism	KSUE18 DraI KSUE18 HindIII
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Source Tissue	leaf
Insert Size	1.5