Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuD14C

[Submit comment/correction]

Locus	ksuD14C
Type	RFLP
Chromosome	7H
Map	Barley-Consensus2-7H 124.7 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 7 ]
Probe	pTtksuD14
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	D014 [ Show all 26 ]
Probe for Locus	pTtksuD14
Locus	ksuD14F [ Show all 28 ]
Type	Genomic STS
PCR primers	R:CCAAAGAGCATCCATGGTGT L:CGCTTTTACCGAGATTGGTC
Specificity	Primer specificity verified, maps on chromosome 1BS.
Polymorphism	KSUD14 EcoRV
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6