Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuD14B

[Submit comment/correction]

Locus	ksuD14B
Type	RFLP
Map	Hordeum-Bins-1H 48 Hordeum-KxM-1H 70.3
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, KxM
Probe	pTtksuD14
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	D014 [ Show all 26 ]
Probe for Locus	pTtksuD14
Locus	ksuD14F [ Show all 28 ]
Type	Genomic STS
PCR primers	R:CCAAAGAGCATCCATGGTGT L:CGCTTTTACCGAGATTGGTC
Specificity	Primer specificity verified, maps on chromosome 1BS.
Polymorphism	KSUD14 EcoRV
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6