Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuA1A

[Submit comment/correction]

Locus	ksuA1A
Type	RFLP
Chromosome	1H 7H
Map	Barley-consensus-2003-1H 107.3 [ Show all 14 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 14 ]
Species	Hordeum vulgare
Probe	pTtksuA1
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ksuA1A in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	A001 [ Show all 24 ]
Probe for Locus	pTtksuA1
Locus	Xksu-A1 [ Show all 26 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGATTGTCAACAAGTGCC L:CAACAGAGATATTGCCGTAG
Polymorphism	KSUA1 DraI KSUA1 XbaI KSUA1 EcoRI KSUA1 EcoRV KSUA1 HindIII
Linkage Group	7D / 7DS Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2