Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG652B

[Submit comment/correction]

Locus	cMWG652B
Type	RFLP
Synonym	Synonym cMWG652
Chromosome	4H
Map	Barley-Consensus2-4H 98.2 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 9 ]
Probe	cMWG652
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	cMWG652 [ Show all 14 ]
Probe for Locus	cMWG652
Locus	Xcmwg652-6 [ Show all 19 ]
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	cDNA STS
STS primers	5' GAGCTGCTCGTTCTCGTTGA 5' CACACCTTCTTCTTCCTCTT
STS size	417
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234405 AJ234404 CMWG652-5 CMWG652-3
Linkage Group	6H 6
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	1