Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF43

[Submit comment/correction]

Locus	XksuF43
Type	RFLP
Chromosome	1D 2D 6D
Chromosome Arm	1DS 2DL 6DS
Map	Ta-Physical-Gill-1ABD -86 [ Show all 6 ]
	[ Show Nearby Loci ]
Breakpoint Interval	0/1DS-5 [ Show all 6 ]
Map Data	Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuF43
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	F043a [ Show all 18 ]
Probe for Locus	pTtksuF43
Locus	XksuF43-1B [ Show all 22 ]
Type	Genomic STS
PCR primers	R:TCCAAGATTCACCACTTTTT L:ACGAGGTGCTCGACAAGTTC
Linkage Group	6D/4D,5D (2)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.1