Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF1

[Submit comment/correction]

Locus	XksuF1
Type	RFLP
Chromosome	5D
Chromosome Arm	5DL
Map	Ta-Physical-Gill-5ABD 84 Ta-Physical-Gill-5D 5.14
	[ Show Nearby Loci ]
Breakpoint Interval	5DL-5/0 5L-0.83-0.85
Map Data	Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuF1
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	F001 [ Show all 6 ]
Probe for Locus	pTtksuF1
Locus	XksuF1-2A [ Show all 8 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CAGTGGTTCACGATAGTAGAT L:TTGGATAACTTCAGTCAGATG
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1