Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuD18

[Submit comment/correction]

Locus	XksuD18
Type	RFLP
Chromosome	2A 2D
Chromosome Arm	2AS
Map	Tm-Dubcovsky2-2A -65.2 Wheat-Composite2004-2A 19
	[ Show Nearby Loci ]
Map Data	T. monococcum, DV92 x G3116 Wheat, Composite, 2004
Probe	pTtksuD18
Possible Orthologs	D018a [ Show all 13 ]
Probe for Locus	pTtksuD18
Locus	XksuD18-2 [ Show all 17 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GGACACTAAACTTTAGAGGC L:CCACTGTTAGGATTAGTGATCC
Specificity	Primer specificity verified, maps on chromosome 2AS.
Polymorphism	KSUD18 HindIII
Linkage Group	4D / 2D (2)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2