Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuC2

[Submit comment/correction]

Locus	XksuC2
Type	RFLP
Chromosome	4D
Chromosome Arm	4DL
Map	Ta-Physical-Gill-4ABD 91 Ta-Physical-Gill-4D 4.94
	[ Show Nearby Loci ]
Breakpoint Interval	4DL-12/0 4L-0.86-0.95
Map Data	Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuC2
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	C002 XksuC2-4D
Probe for Locus	pTtksuC2
Locus	XksuC2-4B [ Show all 11 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TTTCGCTGTGGCACTTGTAC L:ATGGAGAAGTCTTACCTCAGC
Specificity	Primer specificity verified, maps on chromosome 4DL.
Linkage Group	4D / 4D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	2.2