Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm247

[Submit comment/correction]

Locus	Xgwm247
Type	Microsatellite
Chromosome	3A 3B 6R
Chromosome Arm	6RL
Map	CIMMYT-integrated-3B 120.84 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Rye, P87 x P105, update Rye_2009_consensus Wheat, CIMMYT Integrated Wheat, Composite, 2004 Wheat, UC1110 x PI610750
Probe	WMS247
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xgwm247-3A [ Show all 7 ]
Probe for Locus	WMS247
Locus	Xgwm247 [ Show all 8 ]
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks	Insert contains repeat (GA)24 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. In 369 Avena sterilis accessions there were 4 alleles of size 39-60 bp, PIC = 0.04.
Type	Genomic PCR SSR
PCR primers	5' GCAATCTTTTTTCTGACCACG 3' 5' ATGTGCATGTCGGACGC 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS247
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring