Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xcfd19-1D

[Submit comment/correction]

Locus	Xcfd19-1D
Type	Microsatellite
Chromosome	1D
Chromosome Arm	1DL
Map	Chinese_Spring_Deletion_SSR_1D 0.705 Ta-Courtot/CS-GPW-1D 66.9 Ta-SSR-2004-1D 59.5 Ta-Synthetic/Opata-GPW-1D 74.7 Triticum-AxF-1D 69.2
	[ Show Nearby Loci ]
Breakpoint Interval	1DL2-0.41-1.00
Map Data	Wheat, Arina x Forno Wheat, Consensus SSR, 2004 Wheat, Courtot x Chinese Spring, GPW Wheat, Physical, SSR Wheat, Synthetic x Opata, GPW
Species	Triticum aestivum
Probe	CFD19
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs	Xcfd19 [ Show all 11 ]
Probe for Locus	CFD19
Locus	Xcfd19-1D [ Show all 12 ]
Reference	Guyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks	Quality Score = D Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (GA)18 Regularity of motif is perfect
Type	PCR SSR
PCR primers	Forward 5' TACGCAGGTTTGCTGCTTCT 3' Reverse 5' GGAGTTCACAAGCATGGGTT 3'
SSR size	267
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	1D/5D/6D
Source Species	Aegilops tauschii