Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbcd276-6B

[Submit comment/correction]

Locus	Xbcd276-6B
Type	RFLP
Chromosome Arm	6BL
Map	Tturgidum-JKxC-6B 214.2
	[ Show Nearby Loci ]
Map Data	T. turgidum, JK x Cham1
Probe	BCD276
Homology	T14728 e-value: 4e-28 probable betaine-aldehyde dehydrogenase (EC 1.2.1.8) - sorghum (fragment) AC008263_15 e-value: 2e-61 (AC008263) Similar to gb from Amaranthus hypochondriacus. ESTs gb|T20662, gb|R90254, gb|AA651436 and gb|AA586226 come from this gene. [Arabidopsis thaliana] [Arabidopsis thaliana]
Remark	Corrected from BCD279 in text
Possible Orthologs	BCD276 Xbcd276
Probe for Locus	BCD276
Locus	BCD276 Xbcd276 Xbcd276-6B
Synonym	Synonym HAR35_15384 HAR35_2180 HAR35_2181
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks	Lambda ZAP II library Restriction Enzyme for CAPS marker is MwoI Bar.LambZAPII [c]
Type	cDNA
PCR primers	5' ttgggccagttgttagtgaaggac 3' 5' caatttgcgtagccgatgataaca 3'
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 63 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	BE438689 BE438780 BCD276_WHE1A0061 BCD276_WHE1A0062
Polymorphism	Durums BCD276 EcoRI
Linkage Group	6L
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf
Insert Size	0.9
PCR size	0.9