Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Stb5

[Submit comment/correction]

Locus	Stb5
Type	Trait
Chromosome	7D
Chromosome Arm	7DS
Map	Wheat-Composite2004-7D 97
	[ Show Nearby Loci ]
Species	Triticum aestivum
Probe	WMS44
Associated Gene	Stb5 (Triticum)
Gene Class	Reaction to Mycosphaerella graminicola (Fuckel) Schroeter
Reference	Arraiano LS et al. (2001) Chromosomal location of a gene for resistance to septoria tritici blotch (Mycosphaerella graminicola) in the hexaploid wheat 'Synthetic 6x' Theoretical and Applied Genetics 103:758-764.
Data Source	Soria, Marcelo A.
Remark	Trait marker Xgwm44-7D Nearby marker on Composite map: Xgwm44 Position on Composite map estimated by GrainGenes.
Probe for Locus	WMS44
Locus	Xgwm44-7D [ Show all 6 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (GA)28 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (GA)x28. Product size 182 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' GTTGAGCTTTTCAGTTCGGC 3' 5' ACTGGCATCCACTGAGCTG 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS44
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring