Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG974

[Submit comment/correction]

Locus	MWG974
Type	RFLP
Chromosome	3H
Chromosome Arm	3HS
Map	Barley-Consensus-3H -12.3 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG974
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG974
Locus	MWG974
Synonym	Synonym HAR35_23373 HAR35_30482
Type	Genomic STS
STS primers	5' GGAAGAGATCACCGTACTCT 5' CACTTGAATCTGCGCAAGGT
STS size	313
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	BH854312 BH854311 MWG974-5 MWG974-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare