Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG966

[Submit comment/correction]

Locus	MWG966
Type	RFLP
Chromosome	6H
Chromosome Arm	6HS
Map	Barley-Consensus-6H -59.1 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	MWG966
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg966-6A
Probe	MWG966
Locus	MWG966 Xmwg966-6A HI081O3 RI021B18
Type	Genomic STS
STS primers	5' GATCAAGCAAGCTAGCTCCA 5' CACAGATGCCACACCGGAAT
STS size	328
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234682 AJ234681 MWG966-5 MWG966-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare