Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG948

[Submit comment/correction]

Locus	MWG948
Type	RFLP
Chromosome	4H
Chromosome Arm	4HS
Map	Barley-Consensus-4H -1.1 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	MWG948
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of MWG948 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg948
Probe	MWG948
Locus	MWG948 Xmwg948
Type	Genomic STS
STS primers	5' GCATTCCGTTTGGACTATGG 5' CGTCGCCGATATTTGTAAGC
STS size	283
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234665 AJ234664 MWG948-5 MWG948-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare