Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG943

[Submit comment/correction]

Locus	MWG943
Type	RFLP
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 20.2 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QKp.HaMo-1H.2 QKp.nab-1H.2 QS/T.HaMo-1H QS/T.nab-1H
Map Data	Barley consensus [ Show all 11 ]
Probe	MWG943
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG943
Locus	MWG943
Synonym	Synonym HAR35_24493 HAR35_39382
Type	Genomic STS
STS primers	5' GACGTTCGCCTGCGCCATGAGCAAC 5' CTTGTAGAGCGTCATCAGCATCGCG
STS size	295
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234661 AJ234660 MWG943-5 MWG943-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare