Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG932

[Submit comment/correction]

Locus	MWG932
Type	RFLP
Chromosome	3H 3R
Chromosome Arm	3HL 3RL
Map	Barley-Consensus-3H 66.6 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	MWG932
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg932 Xmwg932-3R
Probe	MWG932
Locus	MWG932 Xmwg932 Xmwg932-3R
Synonym	Synonym HAR35_32715 HAR35_3702 HAR35_39058
Type	Genomic STS
STS primers	5' CAGCCATTTCAGACATTGCACATGCT 5' GGAATCAGTATTGGCATTGCATGGTG
STS size	336
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234653 AJ234652 MWG932-5 MWG932-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare