Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG914

[Submit comment/correction]

Locus	MWG914
Type	RFLP
Chromosome	5H
Map	Barley-Consensus2-5H 116 [ Show all 6 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QHd.HaTR-5H QLr.HaTR-5H QNb.HaTR-5H
Map Data	Barley consensus 2 [ Show all 6 ]
Probe	MWG914
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Xmwg914 Xmwg914-5B Xmwg914a mwg914 mwg914-5B
Probe	MWG914
Locus	Xmwg914-5B [ Show all 6 ]
Synonym	Synonym HAR35_42173
Type	Genomic STS
STS primers	5' GCCATGACCGTCTTCCC 5' CCCCATAACATTCGGGTATG
STS size	269
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234644 MWG914-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare