Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG904

[Submit comment/correction]

Locus	MWG904
Type	RFLP
Chromosome	3H
Chromosome Arm	3HL
Map	Barley-Consensus-3H 7.7 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	MWG904
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG904
Locus	MWG904 HD020L24
Type	Genomic STS
STS primers	5' GTCGATCACGCATTTCCTCCG 5' TGTTCCCATTGTCCACCAGCG
STS size	272
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234640 AJ234639 MWG904-5 MWG904-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare