Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG889B

[Submit comment/correction]

Locus	MWG889B
Type	CAPS RFLP
Chromosome	7H
Map	Hordeum-Bins-7H 94 Hordeum-HxT-base-7H 131.3 Hv-Consensus2006-Marcel-7H 98.83 Hv-Integrated2009-7H 99.7 Hv-L94/Vada-2006-7H 101.7
	[ Show Nearby Loci ]
QTL with Locus Marker	QGwe.HaTR-7H.2
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, HxT basemap Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006
Species	Hordeum vulgare
Probe	MWG889 MWG889B
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec
Possible Orthologs	MWG889 MWG889(HT) MWG889(IF) MWG889-2H MWG889A
Probe for Locus	MWG889
Locus	MWG889 [ Show all 6 ]
Type	Genomic STS
STS primers	5' CCCTGAATTCACGCGTTATT 5' GAATGAGCAACTACCGCATA
STS size	378
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234623 AJ234622 MWG889-5 MWG889-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare