Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG878A

[Submit comment/correction]

Locus	MWG878A
Type	RFLP
Synonym	Synonym gsh6 (Hordeum)
Chromosome	2H
Map	Barley-Consensus2-2H 19.7 [ Show all 8 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QYld.TyVo-2H.1
Map Data	Barley consensus 2 [ Show all 8 ]
Probe	MWG878
Associated Gene	gsh6 (Hordeum)
Gene Class	Eceriferum (glossy)
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Kleinhofs A (2000) Coordinator's report: integrating molecular and morphological/physiological marker maps. [electronic resource] Barley Genetics Newsletter 32:152-159.
Data Source	Close, Timothy J.
Possible Orthologs	MWG878 [ Show all 7 ]
Probe for Locus	MWG878
Locus	MWG878 [ Show all 8 ]
Synonym	Synonym HAR35_11279 HAR35_28024 HAR35_45298
Type	Genomic STS
STS primers	5' CTGTCTGCTTGTGCAAATGG 5' GCTTGAATCTGGTATGGTGC
STS size	272
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234611 AJ234610 MWG878-5 MWG878-3
Linkage Group	2H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8