Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG878

[Submit comment/correction]

Locus	MWG878
Type	RFLP
Chromosome	2H
Chromosome Arm	2HS
Map	Barley-Consensus-2H -54.6 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QTil.TyVo-2H.1
Map Data	Barley consensus [ Show all 18 ]
Species	Hordeum vulgare
Probe	MWG878
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Remark	Number of populations contributing to the placement of MWG878 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	MWG878-2H [ Show all 7 ]
Probe	MWG878
Locus	MWG878 [ Show all 8 ]
Synonym	Synonym HAR35_11279 HAR35_28024 HAR35_45298
Type	Genomic STS
STS primers	5' CTGTCTGCTTGTGCAAATGG 5' GCTTGAATCTGGTATGGTGC
STS size	272
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234611 AJ234610 MWG878-5 MWG878-3
Linkage Group	2H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8