Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG851D

[Submit comment/correction]

Locus	MWG851D
Type	RFLP
Synonym	Synonym MWG851
Chromosome	5H
Map	Barley-Consensus2-5H 193.3 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 10 ]
Probe	MWG851
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG851 [ Show all 6 ]
Probe for Locus	MWG851
Locus	MWG851b [ Show all 8 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGCAATACCAGCAAACTCA 5' CATAGCAGAACGTCTCAAGT
STS size	301
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234592 AJ234591 MWG851-5 MWG851-3
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.6