Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG851

[Submit comment/correction]

Locus	MWG851
Type	RFLP
Synonym	Synonym MWG851a MWG851b MWG851C MWG851D
Chromosome	5H
Map	Barley-ConsensusFHB-5H 194.8 Hordeum-FxS-FHB-QTL-5H 248.6
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2023, FHB Barley, FxS, FHB QTL
Probe	MWG851
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Possible Orthologs	MWG851a [ Show all 6 ]
Probe	MWG851
Locus	MWG851b [ Show all 8 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGCAATACCAGCAAACTCA 5' CATAGCAGAACGTCTCAAGT
STS size	301
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234592 AJ234591 MWG851-5 MWG851-3
Linkage Group	Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.6