Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG835

[Submit comment/correction]

Locus	MWG835
Type	RFLP STS
Synonym	Synonym MWG835A MWG835B
Chromosome	5H
Map	Barley-Consensus2-5H 31.9 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 6 ]
Species	Hordeum vulgare
Probe	MWG835
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	MWG835A [ Show all 6 ]
Probe	MWG835
Locus	MWG835 [ Show all 7 ]
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	Genomic STS
STS primers	5' TTCCCTATTCAAGCCATCAGCAAA 5' GTAACCCATAGATAGCATCTTGTG
STS size	565
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 65 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234580 MWG835-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare