Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG632C

[Submit comment/correction]

Locus	MWG632C
Type	RFLP
Chromosome	5H
Map	Hordeum-Bins-5H 191 Hordeum-FxS-FHB-QTL-5H 249.1
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, FxS, FHB QTL
Probe	MWG632
Reference	Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	MWG632 [ Show all 7 ]
Probe for Locus	MWG632
Locus	MWG632b [ Show all 8 ]
Synonym	Synonym HAR35_730
Type	Genomic STS
STS primers	5' CAACAGCAGCACAAGGTCGCTGCCT 5' GGTGGAAGCCAAGTCTGACATCGTC
STS size	473
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234546 MWG632-5
Polymorphism	MWG632 EcoRI [ Show all 6 ]
Insert Enzyme	PstI
Source Species	Hordeum vulgare