Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG528

[Submit comment/correction]

Locus	MWG528
Type	RFLP
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-Consensus-7H 25.1 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	MWG528
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG528
Locus	MWG528
Synonym	Synonym HAR35_23554
Type	Genomic STS
STS primers	5' GCCCATCTGCGGCATCATGG 5' TTCGTTCCAGGACACGGCGG
STS size	160
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234488 AJ234487 MWG528 MWG528-5 MWG528-3
Linkage Group	7H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	0.9