Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG511

[Submit comment/correction]

Locus	MWG511
Type	RFLP STS
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-Consensus-7H 3.8 [ Show all 9 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QGms.HaTR-7H
Map Data	Barley consensus [ Show all 9 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	MWG511
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Probe	MWG511
Locus	MWG511
Type	Genomic STS
STS primers	5' CTCATCCTCTTGTTCAGGAGC 5' TAGCTGCGGCATGTGTTCG
STS size	ca. 1100
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234476 AJ234475 MWG511-5 MWG511-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare