Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2068

[Submit comment/correction]

Locus	MWG2068
Type	CAPS RFLP
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-Consensus-2H 78.1 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	MWG2068
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Igri x Franka
Probe	MWG2068
Locus	MWG2068
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Remarks	Restriction Enzyme for CAPS marker is Hae III; Sau96 I
Type	Genomic STS
STS primers	5' CCGTGAGATGTAAGTTGCTGG 5' ATGCGTTGGCCCATTGG
STS size	ca. 700
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234751 AJ234750 MWG2068-5 MWG2068-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare