Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: MWG2040B

[Submit comment/correction]

Locus	MWG2040B
Type	RFLP
Synonym	Synonym MWG2040
Chromosome	5H
Map	Barley-Consensus2-5H 53.1 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 11 ]
Probe	MWG2040
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	MWG2040 MWG2040A MWG2040C MWG2040D Xmwg2040-3
Probe for Locus	MWG2040
Locus	MWG2040B [ Show all 8 ]
Type	Genomic STS
STS primers	5' GATGAGATGTGACTTCGACA 5' CTTCACAACATGCCTAAGAT
STS size	319
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234731 MWG2040-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare