Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: His4B

[Submit comment/correction]

Locus	His4B
Type	Gene RFLP
Synonym	Synonym His4 pTH011 pTHO11
Chromosome	3H
Map	Barley-Consensus2-3H 80.9 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QNb.StMo-3H.2 QYld.StMo-3H.2
Map Data	Barley consensus 2 [ Show all 16 ]
Species	Hordeum vulgare
Probe	His4 pTH011 pTHO11
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	His4A
Probe for Locus	His4
Locus	His4A His4B His4C
Synonym	Please see pTH011
Reference	Tabata T et al. (1983) The structural organization and DNA sequence of a wheat histone H4 gene Nucleic Acids Research 11:5865-5875.
Type	cDNA STS
PCR primers	CATGTCTGGGCGCGACAAGG CCGAAGCCGTAGAGGGTGCG
Source Species	Triticum aestivum